View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_19 (Length: 381)
Name: NF18588_low_19
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 149 - 375
Target Start/End: Original strand, 36467787 - 36468014
Alignment:
| Q |
149 |
aaacccatcacgtgcnnnnnnntattaaaatttgaatctttaactttccttgttgatagatcactttcatataccactgaatcttt-ctacttttgatct |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36467787 |
aaacccatcacgtgcaaaaaaatattaaaatttgaatctttaactttccttgttgatagatcactttcatataccactgaatctttgctacttttgatct |
36467886 |
T |
 |
| Q |
248 |
caactgaattccaatttggtttttaggtttgtttatgctcgtgcatctttgtgggtcagtatgaacaactagtccaaattattctcatcacatgatttat |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467887 |
caactgaattccaatttggtttttaggtttgtttatgctcgtgcatctttgtgggccagtatgaacaactagtccaaattattctcatcacatgatttat |
36467986 |
T |
 |
| Q |
348 |
atgttttttgatttgatatgatgatgtc |
375 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36467987 |
atgttttttgatttgatatgatgatgtc |
36468014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 47 - 103
Target Start/End: Original strand, 36467685 - 36467741
Alignment:
| Q |
47 |
ctcttcttcgttgaaattcctgtttcaattactgttactgtaagataccctcttctc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467685 |
ctcttcttcgttgaaattcctgtttcaattactgttactgtaagataccctcttctc |
36467741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 314 - 375
Target Start/End: Original strand, 603321 - 603382
Alignment:
| Q |
314 |
aactagtccaaattattctcatcacatgatttatatgttttttgatttgatatgatgatgtc |
375 |
Q |
| |
|
||||| |||||||||||||||||| |||||| |||||||||||||||| |||| |||||||| |
|
|
| T |
603321 |
aactattccaaattattctcatcatatgattcatatgttttttgattttatataatgatgtc |
603382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 603256 - 603304
Alignment:
| Q |
191 |
actttccttgttgatagatcactttcatataccactgaatctttctact |
239 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
603256 |
actttccttgttcatagatcactttcatataccactgaatcttgctact |
603304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University