View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_27 (Length: 312)
Name: NF18588_low_27
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 41 - 295
Target Start/End: Original strand, 44370099 - 44370353
Alignment:
| Q |
41 |
tcaaatttatctaaataacactcctaccctcgcttaggtttcatttctacttcttttgtttcctttcattcagcaaaacataaatgggttcgtctgtcta |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44370099 |
tcaaatttatctaaataacactctcaccctcgcttaggtttcatttctacttcttttgtttcctttcattcagcaaaacataaatgggttcgtctgccta |
44370198 |
T |
 |
| Q |
141 |
agcaattgttccgttttgtgccatgaacaactacaaactaggaactaatttccacaaaatatatacaactacaaatcaagtcaaacacgttctctcattt |
240 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44370199 |
agcaattgttctgttttgtgccatgaacaactacaaactgggaactaatttccacaaaatatatacaactacaaatcaagtcaaacacgttctctcattt |
44370298 |
T |
 |
| Q |
241 |
gatagtaatgttgcatttaaacaaacccgaaaattatcttatttacaacccaaac |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44370299 |
gatagtaatgttgcatttaaacaaacccgaaaattatcttatttacaacccaaac |
44370353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University