View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_34 (Length: 296)
Name: NF18588_low_34
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_34 |
 | |
|
| [»] scaffold0288 (4 HSPs) |
| | |
|
Alignment Details
Target: scaffold0288 (Bit Score: 175; Significance: 3e-94; HSPs: 4)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 63 - 268
Target Start/End: Original strand, 15315 - 15518
Alignment:
| Q |
63 |
attatcacacaaacttaaaatagtgatattgcgttaagtctatttttgattcggtcactacacaagtctaaagtcaggcgactatgccaaatcctctttt |
162 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15315 |
attatcgcacaaacttaaaatagtgat--tgagttaagtctatttttgattcggtcactacacaagtctaaagtcaggcgactatgccaaatcatctttt |
15412 |
T |
|
| Q |
163 |
ggtttggcatcacaaatcttcctgtctgtggctatgccaaatactcttttggcttggtcatcgcaaaaatctctaaatcctctattctctttttgttcgg |
262 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15413 |
ggtttggcatcacaaatcttcctgtccgtggctatgccaaatactcttttggcttggtcatcgcaaaaatctctaaatcctctatcctctttttgttcgg |
15512 |
T |
|
| Q |
263 |
ttattg |
268 |
Q |
| |
|
|||||| |
|
|
| T |
15513 |
ttattg |
15518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 15211 - 15252
Alignment:
| Q |
1 |
tagatgagcttaatcatcttttagttcgattatcgcacaaac |
42 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15211 |
tagatgcgcttaatcatcttttagttcgattatcgcacaaac |
15252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 63 - 118
Target Start/End: Original strand, 15239 - 15292
Alignment:
| Q |
63 |
attatcacacaaacttaaaatagtgatattgcgttaagtctatttttgattcggtc |
118 |
Q |
| |
|
|||||| |||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
15239 |
attatcgcacaaacttaaaatagtgat--tgagttaagtctatttttgattcggtc |
15292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 15294 - 15328
Alignment:
| Q |
8 |
gcttaatcatcttttagttcgattatcgcacaaac |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15294 |
gcttaatcatcttttagttcgattatcgcacaaac |
15328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University