View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_39 (Length: 265)
Name: NF18588_low_39
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 16267753 - 16267992
Alignment:
| Q |
20 |
cagttttgggtatggactttgcgaagatgattgtgattcaaactgtttcagttcaagatgtgccagaaaatacagcttcttcagcaaatatattactggg |
119 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16267753 |
cagttttgggtatggaatttgcgaagatgattgtgattcaaactgttgcagttcaagatgtgccagaaaatacagcttcttcaacaaatatattactggg |
16267852 |
T |
|
| Q |
120 |
acatgtgctcaatatgtgggcaatgatcttcaatatctgaacgataggtattgcatttgtgaatataacgatgaagaatattgaattgctttaaatcctt |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
16267853 |
acatgtgctcaatatgttggcaatgatcttcaatatctgaacgataggtattgcatttgtgaatatgacgatgaagaatattaaattgctttaaatcctt |
16267952 |
T |
|
| Q |
220 |
gccaattgaaaatcataaatgtaataaaaacctatgctact |
260 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
16267953 |
gccaattg-aaatcataaatgtactaaaaacctatgttact |
16267992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University