View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_45 (Length: 253)
Name: NF18588_low_45
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 8713230 - 8713349
Alignment:
| Q |
19 |
atagcagttatgcgggtggtcaggaaactttgattaattcatgtttatttttatgtggttacattttacatatagttgtgtacttctacttctagtagat |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
8713230 |
atagcagttatgtgggtggtcaggaaactttgattaattcatgtttatttttatgtggttacattttacatatagctatgtacttctacttctagtagat |
8713329 |
T |
|
| Q |
119 |
tttatagtagaatttaattg |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8713330 |
tttatagtagaatttaattg |
8713349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 194 - 252
Target Start/End: Original strand, 8713405 - 8713463
Alignment:
| Q |
194 |
cacattgttttcttcatcgtggaggtgacttttcagcagccttggaaattagttacttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8713405 |
cacattgttttcttcatcgtggaggtgacttttcagcagcctcggaaattagttacttc |
8713463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 8733867 - 8733940
Alignment:
| Q |
19 |
atagcagttatgcgggtggtcaggaaactttgattaattcatgtttatttttatgtggttacattttacatatag |
93 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
8733867 |
atagcagttgtgtgggtggtcaggaaactttgattaatacatgttta-ttttatgcggttacatttttcatatag |
8733940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 241
Target Start/End: Original strand, 8734223 - 8734265
Alignment:
| Q |
198 |
ttgttttcttcatcgtggaggtgacttttcagcagccttggaaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8734223 |
ttgttttcttcatcgtggaggtgactttt-agcagccttggaaa |
8734265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 93
Target Start/End: Complemental strand, 25502040 - 25501967
Alignment:
| Q |
19 |
atagcagttatgcgggtggtcaggaaactttgattaattcatgtttatttttatgtggttacattttacatatag |
93 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
25502040 |
atagcagttgtgtgggtggtcaggaaactttgattaatacatgttta-ttttatgcggttacatttttcatatag |
25501967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University