View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_47 (Length: 249)
Name: NF18588_low_47
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 24336640 - 24336849
Alignment:
| Q |
18 |
gattaaacaatgaaaagaatagtttggcttctaactcaagaaatcatcttgttcaaatgcaaaatccattagatggagaaaagacaccaagaaaatcact |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24336640 |
gattgaacaatgaaaagaatagtttggcttctaactcaagaaatcatcttgttcaaatgcaaaatccattagatggagaaaagacaccaagaaaatcact |
24336739 |
T |
|
| Q |
118 |
tgaagtatttggctcaccaaatccaatattgatcaataccaaaagaaattcattgaccaatgataaaaggttgatatttccaaaaatggaagaaattgat |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24336740 |
tgaagtatttggttcaccaaatccaatattgatcaataccaaaagaaattcattgaccaatgataaaaggttgatatttccaaaaatggaagaaattgat |
24336839 |
T |
|
| Q |
218 |
aatgcaaact |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
24336840 |
aatgcaaact |
24336849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University