View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_53 (Length: 237)
Name: NF18588_low_53
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 17751943 - 17752165
Alignment:
| Q |
1 |
tgtaagatcgattggttgccctaattaggaaaaatgttcggagcagattgtcaaatgcagattaacatccttgtagttatggctataattgatgctgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17751943 |
tgtaagatcgattggttgccctaattaggaaaaatgttaggagcagattgtcaaatgcagattaacatccttgtagttatggctataattgatgccgaat |
17752042 |
T |
|
| Q |
101 |
taggcatactctctgttttcatccgaaaattcccaaggagggaaaatgtaggtctcctggatacccagggtatgggatagatagttttctgtattgatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
17752043 |
taggcatactctctgttttcatccgaaaatccccaaggagggaaaatgtaggtctcctggataccccgggtatgggatagatagttttcagtattgatat |
17752142 |
T |
|
| Q |
201 |
cgagtgtatatcgcattgatact |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
17752143 |
cgagtgtatatcacattgatact |
17752165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 17760930 - 17761152
Alignment:
| Q |
1 |
tgtaagatcgattggttgccctaattaggaaaaatgttcggagcagattgtcaaatgcagattaacatccttgtagttatggctataattgatgctgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17760930 |
tgtaagatcgattggttgccctaattaggaaaaatgttaggagcagattgtcaaatgcagattaacatccttgtagttatggctataattgatgccgaat |
17761029 |
T |
|
| Q |
101 |
taggcatactctctgttttcatccgaaaattcccaaggagggaaaatgtaggtctcctggatacccagggtatgggatagatagttttctgtattgatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
17761030 |
taggcatactctctgttttcatccgaaaatccccaaggagggaaaatgtaggtctcctggataccccgggtatgggatagatagttttcagtattgatat |
17761129 |
T |
|
| Q |
201 |
cgagtgtatatcgcattgatact |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
17761130 |
cgagtgtatatcacattgatact |
17761152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 17737810 - 17737872
Alignment:
| Q |
1 |
tgtaagatcgattggttgccctaattaggaaaaatgttcggagcagattgtcaaatgcagatt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
17737810 |
tgtaagatcgattggttgccctaattaggaaaaatgttgggagcagattgccaattgcagatt |
17737872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 15734354 - 15734413
Alignment:
| Q |
8 |
tcgattggttgccctaattaggaaaaatgttcggagcagattgtcaaatgcagattaaca |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| || ||||||| |||| |
|
|
| T |
15734354 |
tcgattggttgccctaattaggaaaaatgttaggagcagattgccatttgcagatcaaca |
15734413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 130
Target Start/End: Original strand, 17737876 - 17737924
Alignment:
| Q |
82 |
gctataattgatgctgaattaggcatactctctgttttcatccgaaaat |
130 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
17737876 |
gctataattgatgccaaattagctatactctctgttttcatccgaaaat |
17737924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 200
Target Start/End: Original strand, 15734552 - 15734600
Alignment:
| Q |
152 |
gtctcctggatacccagggtatgggatagatagttttctgtattgatat |
200 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| | |||||||||||| |
|
|
| T |
15734552 |
gtctcctggatacctggggtatgagatagatagtgtgctgtattgatat |
15734600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University