View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_57 (Length: 233)
Name: NF18588_low_57
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 4 - 218
Target Start/End: Original strand, 4467145 - 4467346
Alignment:
| Q |
4 |
ggtgctactaagattatatatgcataagattttgaggtgcaaacaggagtatgttgcacaatattatcatataattgtttaagtggagaacgtacaagta |
103 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4467145 |
ggtgctactaagattat----gcataagattttgaggtgcaaacaggagtatgttgcacaatattatcatataattgtttaagtggagagcgtacaagta |
4467240 |
T |
 |
| Q |
104 |
tgtttgaacttagtatgaatgtgtatctgtatttcatcgagttcatgttctatgaaaacatcatcacacttttttaaagacaaatattagaacgtggtac |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4467241 |
tgtttga---------gaatgtgtatctgtatttcatcgagttcatgttctatgaaaacatcatcacacttttttaaagacaaatattagaacgtggtac |
4467331 |
T |
 |
| Q |
204 |
ataaggttcaaaatt |
218 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4467332 |
ataaggttcaaaatt |
4467346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University