View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_low_63 (Length: 204)
Name: NF18588_low_63
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_low_63 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 524188 - 523995
Alignment:
| Q |
11 |
gaacctgtgaaactattacattcaggggcactgtcatataactacaccaaaactgaacaagaacactgcaatgcaaattaagaaatgagagcatgtaaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
524188 |
gaacctgtgaaactattacattcaggggcactgtcatatagctacaccaaaactgaacaagaacgctgcaatgcaaattaagaaatgagagcatctaaga |
524089 |
T |
 |
| Q |
111 |
gtatgaaattgaaaagtattgtagaatctggaaaataagtcaattaagtagaacaaagaattctttagaaagagatgaaacattgaaactaacc |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
524088 |
gtatgaaattgaaaagttttgtagaatctggaaaataagtcaattaaggagaacaaagaattccttagaaagagatgaaacattgaaactaacc |
523995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University