View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_high_30 (Length: 270)
Name: NF18589_high_30
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 252
Target Start/End: Original strand, 8428936 - 8429178
Alignment:
| Q |
10 |
catcatcatgattgggattacacttacaaaatgagaaagtttacctctagcgggagggggagctcgagcggcaactctcaaagcttgcctgtaaagcttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8428936 |
catcatcatgattgggattacacttacaaaatgagaaagtttacctctagcgggagggggagctcgagcggcaactctcaaagcttgcctgtaaagcttg |
8429035 |
T |
 |
| Q |
110 |
aaaattcgagcgcgaataaggaaatcctgcagatccatggacaaactataccaaaaaggagattgaagagaaacattttagtctgtgcattttgacaaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
8429036 |
aaaattcgagcgcgaataaggaaatcctgcagatccatggacaaactataccaaaaaggagattgaagagaagcattttagtctctgcattttgacaaac |
8429135 |
T |
 |
| Q |
210 |
aggtggtgtgcactttcgtgtatttgcggaaaagagagaattg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8429136 |
aggtggtgtgcactttcgtgtatttgcggaaaagagagaattg |
8429178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University