View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_high_40 (Length: 209)
Name: NF18589_high_40
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 187
Target Start/End: Complemental strand, 44305751 - 44305573
Alignment:
| Q |
12 |
aagaatatctgtgtgattcaaagtttgacggttagtgtaaatgccaggttat---gtccccatactaaagaagcaaaatgggattaagataatttagagg |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44305751 |
aagaatatctatgtgattcaaagtttgacggttagtgtaaatgccaggttattatgtccccatactaaagaagcaaaatgggattaagataatttagagg |
44305652 |
T |
 |
| Q |
109 |
caaatgaagatttgttcattttatttttgttatttgttgttaatactaattctgatgattgcttttatttgtctcagct |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44305651 |
caaatgaagatttgttctttttatttttgttatttgttgttaatactaattctgatgattgcttttatttgtcgcagct |
44305573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 12 - 187
Target Start/End: Complemental strand, 43895327 - 43895152
Alignment:
| Q |
12 |
aagaatatctgtgtgattcaaagtttgacggttagtgtaaatgccaggttat---gtccccatactaaagaagcaaaatgggattaagataatttagagg |
108 |
Q |
| |
|
|||||||||| || |||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43895327 |
aagaatatctatgcgattcaaagtttgacggtcagtgtaaatgccaggttattatgtccccatactaaag---caaaatgggattaagataatttagagg |
43895231 |
T |
 |
| Q |
109 |
caaatgaagatttgttcattttatttttgttatttgttgttaatactaattctgatgattgcttttatttgtctcagct |
187 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43895230 |
caaatgaagatttgttctttttatttttgttatttgttgttaatactaattctgatgattgcttttatctgtctcagct |
43895152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University