View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_high_41 (Length: 203)
Name: NF18589_high_41
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 42144820 - 42145006
Alignment:
| Q |
1 |
taatgttctacatttgcatattttggacatcttcatgtatttttggagcagtctatgtatttccgtttgaaaaggtatacttaaggaaagaaaggaaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42144820 |
taatgttctacatttgcatattttggacatcttcatgtatttttggagcagtctatgtatttccgtttgaaaaggtatacttaagaaaagaaaggaaagc |
42144919 |
T |
 |
| Q |
101 |
agacatgtatagacttagtgcatactatgcaagcagcactctatgtgacatggtggcacatgttttgtatcctactgtttttatgct |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144920 |
agacatgtatagacttagtgtatactatgcaagcagcactctatgtgacatggtggcacatgttttgtatcctactgtttttatgct |
42145006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University