View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_high_42 (Length: 201)
Name: NF18589_high_42
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 6469555 - 6469390
Alignment:
| Q |
19 |
gacacgtcatctatttttgttaaactattaccaggtaacctgttgaggcagtttctaaaattttgaattcattcttgaaaatgca--agcaacgcaaggg |
116 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
6469555 |
gacacgtcgtctttttttgttaaactattaccgggtaacctgttgaggcagtttctaaaattttgacttcattcttgaaaacgcataagcaacgcaaggg |
6469456 |
T |
 |
| Q |
117 |
tttgcaaatgtcctttcttcttctaacagcacttctatttctatatcacagttcaaccgttgtggt |
182 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6469455 |
tttgcaaatgtcctttcttcttctaaaaccacttctatttctatatcccagttcaaccgttgtggt |
6469390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University