View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_low_26 (Length: 345)
Name: NF18589_low_26
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 131 - 340
Target Start/End: Complemental strand, 37843782 - 37843573
Alignment:
| Q |
131 |
ctttgttgtttttgcaatgatacctgagaaggggttgcaggggatagagtggtggaagacatggttgatgaggaagattttggttggtttgagaatgaaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843782 |
ctttgttgtttttgcaatgatacctgagaaggggttgcaggggatagagtggtggaagacatggttgatgaggaagattttggttggtttgagaatgaaa |
37843683 |
T |
|
| Q |
231 |
ggtgaatgtaataataagatgattatgtttggnnnnnnnaaaatcttaaaacgaccaccacaattgtcatggataaggcgctaaggccatgtaggtgcca |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843682 |
ggtgaatgtaataataagatgattatgtttggtttttttaaaatcttaaaacgaccaccacaattgtcatggataaggcgctaaggccatgtaggtgcca |
37843583 |
T |
|
| Q |
331 |
catattcttc |
340 |
Q |
| |
|
|||||||||| |
|
|
| T |
37843582 |
catattcttc |
37843573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 37843895 - 37843839
Alignment:
| Q |
18 |
cttcacaagtagtcctattgaaggacatgaaattccactctttccagaacatagctg |
74 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843895 |
cttcacaagtaatcctattgaaggacatgaaattccactctttccagaacatagctg |
37843839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University