View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_low_33 (Length: 297)
Name: NF18589_low_33
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 85 - 287
Target Start/End: Complemental strand, 42896997 - 42896786
Alignment:
| Q |
85 |
ttgtaaatatttaagacaaaattatgatatttttctcaacttttactacttcaatatcaaattttgattgtgtgttttt-ccccacaagtaattttagat |
183 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42896997 |
ttgtaaatatataagacaaaattatgatatttttctcaaattttactccttcaatatcaaattttgattgtgtgtttttcccccacaagtaattttagat |
42896898 |
T |
|
| Q |
184 |
aaaatataaataaaacaaaaatcacactaaatcagatacttccacatcaagataat----------atgtattttcgacattgtagttccctttgttaca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
42896897 |
aaaatataaataaaacaaaaatcacactaaatcagattcttc--catcaagatattacatcagagaatgtattttcgacattgtagttccctttgttaca |
42896800 |
T |
|
| Q |
274 |
ttgtgatgcctatg |
287 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42896799 |
ttgtgatgcctatg |
42896786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 37 - 89
Target Start/End: Complemental strand, 42897150 - 42897098
Alignment:
| Q |
37 |
ttctatttgtcttgtatttccttcttactttatctctaacgtgattgattgta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897150 |
ttctatttgtcttgtatttccttcttactttatctctaacgtgattgattgta |
42897098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University