View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_low_44 (Length: 237)
Name: NF18589_low_44
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 40774371 - 40774164
Alignment:
| Q |
15 |
caccaaccatcttaacaagatcccttgttgcttgtgcaacaatgtcagaacatgaaacaacaccaggacatgctatttccaatgcattttttattttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40774371 |
caccaaccatcttaacaagatcccttgttgcttgtgcaacaatgtcagaacatgaaacaacaccaggacatgctatttccaatgcattttttattttatt |
40774272 |
T |
|
| Q |
115 |
aacgacgtcgtatccatcccctgagagggagaggttgagttctgcgtctttttcagcgtgagggttgtaagccgttgaagagataaggaccgatccatca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40774271 |
aacgacgtcgtatccatcccctgagagggagaggttgatttctgcgtctttttcagcgtgagggttgtaagccgttgaagagataaggaccgatccatca |
40774172 |
T |
|
| Q |
215 |
caaccgtc |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
40774171 |
caaccgtc |
40774164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University