View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18589_low_45 (Length: 237)
Name: NF18589_low_45
Description: NF18589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18589_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40707752 - 40707972
Alignment:
| Q |
1 |
ttagtctaataaacaacaattttcacaaaattaatataagtcacaagagaaaatatgtatcacttaaggcaattttagcttgatgtgattagccaaatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40707752 |
ttagtctaataaacaacaattttcacaaaattaatataagtcacaagagaaaatatgtaccacttaaggcaattttagcttgatgtgattagccaaatga |
40707851 |
T |
 |
| Q |
101 |
ttcatgaccattatgtcattatcattaaacaaatttctttgctttccttccttgaaaatatgtcgtgttaacacatattatacaaccgttcgtactcctt |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
40707852 |
ttcatgaccatgatgtcattatcattaaacaaatttctttgctttccttccttgaaaatatgtcgtgataacacatattatacaaccgtttgtactcctt |
40707951 |
T |
 |
| Q |
201 |
tgcgatatttgaggctggagg |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
40707952 |
tgcgatatttgaggatggagg |
40707972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University