View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_28 (Length: 343)
Name: NF1858_high_28
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 165 - 324
Target Start/End: Complemental strand, 53924866 - 53924707
Alignment:
| Q |
165 |
ttaacagcaaacactaaatagtgtgtttagattgatgttagaggtgctttgaaatgtgcaccaactcgaaacgaaacacaccacactgtaaattgaatca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53924866 |
ttaacagcaaacactaaatagtgtgtttagattgatgttagaggtgctttgaaatgtgcaccaactctaaacgaaacacaccacactgtaaattgaatca |
53924767 |
T |
|
| Q |
265 |
acttcaattcaaggttttcttgttcattcacaagtgtgacaaatagaattaccaccactt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53924766 |
acttcaattcaaggttttcttgttcattcacaagtgtgacaaatagaattaccaccactt |
53924707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 53924918 - 53924880
Alignment:
| Q |
176 |
cactaaatagtgtgtttagattgatgttagaggtgcttt |
214 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
53924918 |
cactaattagtatgtttagattgatgttagaggtgcttt |
53924880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University