View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_36 (Length: 329)
Name: NF1858_high_36
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_36 |
 |  |
|
| [»] chr1 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 153 - 329
Target Start/End: Complemental strand, 48043734 - 48043565
Alignment:
| Q |
153 |
gggattccactgctggttctaggt-aataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgtgatcctttg |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043734 |
gggattccactgctggttctaggttaataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgtgatcctttg |
48043635 |
T |
 |
| Q |
252 |
atttcaaaaaatttgcnnnnnnncaggatgtgctcgtactttccattcatatgatgttgtttcacatgagcaggggac |
329 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043634 |
atttcaaaaaatttgctttttttcaggatgtgc--------tccattcatatgatgttgtttcacatgagcaggggac |
48043565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 158 - 329
Target Start/End: Complemental strand, 48051701 - 48051531
Alignment:
| Q |
158 |
tccactgctggttctaggtaataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgtgatcctttgatttca |
257 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
48051701 |
tccactgctggttctaagtaacaagattgataaacctggggatttgtctaagcaagacctgacagaaaaggtttaagtagtgtgtgatcctatgatttc- |
48051603 |
T |
 |
| Q |
258 |
aaaaatttgcnnnnnnncaggatgtgctcgtactttccattcatatgatgttgtttcacatgagcaggggac |
329 |
Q |
| |
|
||| || || ||||||||| ||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
48051602 |
aaattttagcttttaatcaggatgtgtccgtacttgcctttcatatgatgttgtttcacatgtgcaggggac |
48051531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 48043923 - 48043874
Alignment:
| Q |
19 |
gcagccgcttatgagaatttacctgcttcaagaagtgaactccatgactt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043923 |
gcagccgcttatgagaatttacctgcttcaagaagtgaactccatgactt |
48043874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 48056968 - 48056891
Alignment:
| Q |
165 |
ctggttctaggtaataagattgacaaacctggggatttgtctaagcaagacctgacaaaaaagatttaagtagtgtgt |
242 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||||||||||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
48056968 |
ctggttcttggtaataagattgacaaacctggtgctttgtctaagcaagacacgacagaaaagatgtaagtactgtgt |
48056891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 154 - 221
Target Start/End: Complemental strand, 48045552 - 48045485
Alignment:
| Q |
154 |
ggattccactgctggttctaggtaataagattgacaaacctggggatttgtctaagcaagacctgaca |
221 |
Q |
| |
|
|||||| | |||||||| |||||||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
48045552 |
ggattcaattgctggttttaggtaataaaattgacaaacctgacaatttgtctaagcaagacccgaca |
48045485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 48043832 - 48043794
Alignment:
| Q |
70 |
aaagaatggagtgataagggtgatctcagattcaattcc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48043832 |
aaagaatggagtgataagggtgatctcagattcgattcc |
48043794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University