View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_45 (Length: 285)
Name: NF1858_high_45
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 33221184 - 33221327
Alignment:
| Q |
16 |
aatatataccaaagtcttaaagggttggcttcaaacttaagatctaagcctcaaaaaacagttttttgtgcagaagtttatctgtaacaaaagtatagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33221184 |
aatatataccaaagtcttaaagggttggcttcaaacttaagatctaagcctcaaaaaacagttttttgtgcagaagtttatctgtaacaaaagtatagaa |
33221283 |
T |
 |
| Q |
116 |
aaagggtcagaacaaggagaagatattaagaaaaacaccctcaa |
159 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33221284 |
aaagggtcagaacaaggcgaagatattaagaaaaacaccctcaa |
33221327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 232 - 271
Target Start/End: Complemental strand, 16824375 - 16824336
Alignment:
| Q |
232 |
ggtgaatgagatttctgaaagtgatgatgaaagttcttct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16824375 |
ggtgaatgagatttctgaaagtgatgatgaaagttcttct |
16824336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University