View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_53 (Length: 257)
Name: NF1858_high_53
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 75 - 238
Target Start/End: Original strand, 3445973 - 3446136
Alignment:
| Q |
75 |
tgatcacttgtgattatgacattaaaactgtgtctagccagcaaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacataatt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3445973 |
tgatcacttgtgattatgacattaaaactgtgtctagccagcgaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacatattt |
3446072 |
T |
|
| Q |
175 |
tgttcacccacctaccaatacaatgacatgaacagtgcttttgtatattctgggtatggttggg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446073 |
tgttcacccacctaccaatacaatgacatgaacagtgcttttgtatattctgggtatggttggg |
3446136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University