View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_57 (Length: 254)
Name: NF1858_high_57
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 45400830 - 45400607
Alignment:
| Q |
12 |
atgagatgaagtcttgataacaatgtgatccatgcactaaaaaatgaacatgtggcaatcaacttacatggtaggtgtcgtgaaacaaacaacaaatgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45400830 |
atgagatgaagtcttgataacaatgtgatccatgcactaaaaaatgaacatgtggcaatcaaattacatggtaggtgtcgtgaaacaaacaacaaatgat |
45400731 |
T |
|
| Q |
112 |
tagttcagcttttattggatcttgggatttccgattcaaatcactttttaatttaacattggaccgttcttgatgtcagaggggagatagtagtttgtgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45400730 |
tagttcagcttttattggatcttgggatttccgattcaattcactttttaatttaacattggaccgttcttgatgtcagaggggagatagtagtttgtgt |
45400631 |
T |
|
| Q |
212 |
atgtgtgttctgaaataacactag |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45400630 |
atgtgtgttctgaaataacactag |
45400607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University