View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_64 (Length: 248)
Name: NF1858_high_64
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 49866152 - 49866370
Alignment:
| Q |
16 |
atgagaaaggaaaagaagtgcttgcgtgaggttatctgatattgtgatttccacataggaagcaagaatttggttagtcagcacataagagttgatataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49866152 |
atgagaaaggaaaagaagtgcttgcgtgaggttatctgatattgtgatttccacataggaagcaagaatttggttagtcagcacataagagttgatataa |
49866251 |
T |
 |
| Q |
116 |
----gtaaaacaaatgtagacataagatttttagggtcatggcaagggttttgtacatttagtgtctttgccatagtcaagaagctgagtggtgtaattg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49866252 |
ataagtaaaacaaatgtagacataagatttttagggtcatggcaagggttttgtacatttagtgtctttgccatagtcaagaagctgagtggtgtaattg |
49866351 |
T |
 |
| Q |
212 |
ttaatcgctcccacaacac |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49866352 |
ttaatcgctcccacaacac |
49866370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University