View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_78 (Length: 230)
Name: NF1858_high_78
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 113 - 211
Target Start/End: Complemental strand, 32575502 - 32575402
Alignment:
| Q |
113 |
tgagtaactaaataaactgacaagcactcagccttttgtatggcttgtttatatttttctaaaatat--actgtaaaatactgtaagtggacatccctca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
32575502 |
tgagtaactaaataaactgacaagcactcagccttttgtatggcttgtttatatttttctaaaatatagacggtaaaatactgtaagtggacatccctca |
32575403 |
T |
 |
| Q |
211 |
t |
211 |
Q |
| |
|
| |
|
|
| T |
32575402 |
t |
32575402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 32570416 - 32570356
Alignment:
| Q |
92 |
aatatgagatataaacaaacatgagtaactaaataaactgacaagcactcagccttttgtat |
153 |
Q |
| |
|
||||||||||| |||||||| |||||||||| || |||||||| |||||| ||||||||||| |
|
|
| T |
32570416 |
aatatgagatacaaacaaacctgagtaactagatcaactgacatgcactc-gccttttgtat |
32570356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University