View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1858_high_81 (Length: 221)

Name: NF1858_high_81
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1858_high_81
NF1858_high_81
[»] chr5 (1 HSPs)
chr5 (132-204)||(9995981-9996053)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 132 - 204
Target Start/End: Original strand, 9995981 - 9996053
Alignment:
132 taattgacctgccatgaaaaagttgatgatcgtacaagaaaaagcgatgttgaaatgaagagaactatgtatg 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9995981 taattgacctgccatgaaaaagttgatgatcgtacaagaaaaagcgatgttgaaatgaagagaactatgtatg 9996053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University