View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_high_86 (Length: 201)
Name: NF1858_high_86
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_high_86 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 75 - 187
Target Start/End: Complemental strand, 42358234 - 42358127
Alignment:
| Q |
75 |
aggtggttggttatcttttacatacactgtcagtatgctatgcttagattagatgctatatatacaattcggctctgtcgtctctgcgtgcattaatatg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358234 |
aggtggttggttatcttttacatacactgtcagtatgctatgcttagat-----gctatatatacaattcggctctgtcgtctctgcgtgcattaatatg |
42358140 |
T |
|
| Q |
175 |
aatatcaaagtac |
187 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
42358139 |
aatatcgaagtac |
42358127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University