View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1858_high_86 (Length: 201)

Name: NF1858_high_86
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1858_high_86
NF1858_high_86
[»] chr8 (1 HSPs)
chr8 (75-187)||(42358127-42358234)


Alignment Details
Target: chr8 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 75 - 187
Target Start/End: Complemental strand, 42358234 - 42358127
Alignment:
75 aggtggttggttatcttttacatacactgtcagtatgctatgcttagattagatgctatatatacaattcggctctgtcgtctctgcgtgcattaatatg 174  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||    
42358234 aggtggttggttatcttttacatacactgtcagtatgctatgcttagat-----gctatatatacaattcggctctgtcgtctctgcgtgcattaatatg 42358140  T
175 aatatcaaagtac 187  Q
    |||||| ||||||    
42358139 aatatcgaagtac 42358127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University