View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1858_low_31 (Length: 343)

Name: NF1858_low_31
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1858_low_31
NF1858_low_31
[»] chr3 (2 HSPs)
chr3 (165-324)||(53924707-53924866)
chr3 (176-214)||(53924880-53924918)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 165 - 324
Target Start/End: Complemental strand, 53924866 - 53924707
Alignment:
165 ttaacagcaaacactaaatagtgtgtttagattgatgttagaggtgctttgaaatgtgcaccaactcgaaacgaaacacaccacactgtaaattgaatca 264  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
53924866 ttaacagcaaacactaaatagtgtgtttagattgatgttagaggtgctttgaaatgtgcaccaactctaaacgaaacacaccacactgtaaattgaatca 53924767  T
265 acttcaattcaaggttttcttgttcattcacaagtgtgacaaatagaattaccaccactt 324  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53924766 acttcaattcaaggttttcttgttcattcacaagtgtgacaaatagaattaccaccactt 53924707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 53924918 - 53924880
Alignment:
176 cactaaatagtgtgtttagattgatgttagaggtgcttt 214  Q
    |||||| |||| |||||||||||||||||||||||||||    
53924918 cactaattagtatgtttagattgatgttagaggtgcttt 53924880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University