View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_low_45 (Length: 294)
Name: NF1858_low_45
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 279
Target Start/End: Complemental strand, 36570881 - 36570833
Alignment:
| Q |
231 |
ttcaaaattacagaaataaagggtttatcaatgcagatctgaagaacac |
279 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36570881 |
ttcaaaattccagaaataaagggtttatcaatgcagatctgaagaacac |
36570833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 228 - 279
Target Start/End: Original strand, 52603725 - 52603776
Alignment:
| Q |
228 |
agattcaaaattacagaaataaagggtttatcaatgcagatctgaagaacac |
279 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
52603725 |
agattcaaaattccagaaataaaggttttatcaatgtagatctgaagaacac |
52603776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 77 - 126
Target Start/End: Complemental strand, 39233737 - 39233688
Alignment:
| Q |
77 |
tagctacatagtaaatacacaaaaatcttgaaataatttttccataacat |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39233737 |
tagctacatgataaatacacaaaaatcttgaaacaatttttccataacat |
39233688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University