View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_low_55 (Length: 260)
Name: NF1858_low_55
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 18244430 - 18244658
Alignment:
| Q |
20 |
atgaccaatttgttttctttggtgaagctacaaattagaactgctaaaattgtaaaaagtgcttacaatatggttttacttttacctagttgagtaaaaa |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18244430 |
atgaccaatttgtt--ctttggtgaagctacaaattagaactgctaaaattgtaaaaagtgcttacaatatggttttacttttacctagttgagtaaaaa |
18244527 |
T |
|
| Q |
120 |
taaggttccctataagatagggaatttgagataaccacaaatgtatgtatggccatatatattgtcagtaagtcttgcagaaaggggtcattctattctc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18244528 |
taaggttccctataagatagggaatttgagataaccacaaatgtatgtatggccatatatattgtcagtaagtcttgcagaaaggggtcattctattcta |
18244627 |
T |
|
| Q |
220 |
gctgtcagacgtcttcttatgccgtcctttg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18244628 |
gctgtcagacgtcttcttatgccgtcctttg |
18244658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University