View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1858_low_57 (Length: 257)

Name: NF1858_low_57
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1858_low_57
NF1858_low_57
[»] chr4 (1 HSPs)
chr4 (75-238)||(3445973-3446136)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 75 - 238
Target Start/End: Original strand, 3445973 - 3446136
Alignment:
75 tgatcacttgtgattatgacattaaaactgtgtctagccagcaaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacataatt 174  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
3445973 tgatcacttgtgattatgacattaaaactgtgtctagccagcgaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacatattt 3446072  T
175 tgttcacccacctaccaatacaatgacatgaacagtgcttttgtatattctgggtatggttggg 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3446073 tgttcacccacctaccaatacaatgacatgaacagtgcttttgtatattctgggtatggttggg 3446136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University