View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_low_70 (Length: 245)
Name: NF1858_low_70
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 33119514 - 33119747
Alignment:
| Q |
1 |
ttgattgaaaaaagcgggagaaagaaactcgctttaataagtttgacaggagttgtaggatcgctaattcttcttaccgttgtttttcatcagactgcga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33119514 |
ttgattgaaaaaagcgg-agaaagaaactcgctttaataagtttgacaggagttgtaggatcactaattcttcttaccgttgtttttcatcagactgcga |
33119612 |
T |
 |
| Q |
101 |
ttacctcaccacttattagtccaacagaaactgctaacttcaattccacttgccctggttactctaaagctattgaccctgctaaatgggattgtatgac |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33119613 |
ttacctcaccacttattagtccaactgaaactgctaacttcaattccacttgccctggttactctaaagctattgaccctgctaaatgggattgtatgac |
33119712 |
T |
 |
| Q |
201 |
ttgtcttaaagatgaatcaaattgtggcttctgtg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33119713 |
ttgtcttaaagatgaatcaaattgtggcttctgtg |
33119747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University