View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1858_low_83 (Length: 230)

Name: NF1858_low_83
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1858_low_83
NF1858_low_83
[»] chr1 (2 HSPs)
chr1 (113-211)||(32575402-32575502)
chr1 (92-153)||(32570356-32570416)


Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 113 - 211
Target Start/End: Complemental strand, 32575502 - 32575402
Alignment:
113 tgagtaactaaataaactgacaagcactcagccttttgtatggcttgtttatatttttctaaaatat--actgtaaaatactgtaagtggacatccctca 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||||||||||||||||||||||||    
32575502 tgagtaactaaataaactgacaagcactcagccttttgtatggcttgtttatatttttctaaaatatagacggtaaaatactgtaagtggacatccctca 32575403  T
211 t 211  Q
    |    
32575402 t 32575402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 32570416 - 32570356
Alignment:
92 aatatgagatataaacaaacatgagtaactaaataaactgacaagcactcagccttttgtat 153  Q
    ||||||||||| |||||||| |||||||||| || |||||||| |||||| |||||||||||    
32570416 aatatgagatacaaacaaacctgagtaactagatcaactgacatgcactc-gccttttgtat 32570356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University