View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858_low_86 (Length: 221)
Name: NF1858_low_86
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 64 - 205
Target Start/End: Original strand, 33043010 - 33043151
Alignment:
| Q |
64 |
tatcttctaataccatattagagcatgacactcaagagaaaaaactagctgtgattgcaatatgcatttcattattgatcaaatgaactttaaagtaaac |
163 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33043010 |
tatcttctaataccgtattagagcatgacactcgagagaaaaaactagttgtgattgcaatatgcatttcattattgatcaaatgaactttaaagtaaac |
33043109 |
T |
 |
| Q |
164 |
gagctagctcaccatacataagctagtgatgaagctctaact |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33043110 |
gagctagctcaccatccataagctagtgatgaagctctaact |
33043151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 89 - 155
Target Start/End: Original strand, 33040962 - 33041028
Alignment:
| Q |
89 |
tgacactcaagagaaaaaactagctgtgattgcaatatgcatttcattattgatcaaatgaacttta |
155 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
33040962 |
tgacactcaagagagaaaattaattgtgattgcaagatgcatttcactattgatcatctgaacttta |
33041028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University