View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18590_low_2 (Length: 279)
Name: NF18590_low_2
Description: NF18590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18590_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 32288241 - 32288510
Alignment:
| Q |
1 |
atatggcactgctgctcctggatttggcgatgcaaatgctggtggaggacagggtggacaagaagcaaatatgggcggcggcggcggtggtgctgcaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32288241 |
atatggcactgctgctcctggatttggcgatgcaaatgctggtggaggacagagtggacaagaagcaaatatgggtggcggcggcggtggtgctgcaggt |
32288340 |
T |
 |
| Q |
101 |
ggcaatgctggaatgaacatgaacatgggtggcaataagcagaaatgaagaagctgcgtgcattgatatataaggtcatgggtcatagctagctatagta |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288341 |
ggcaatactggaatgaacatgaacatgggtggcaataagcagaaatgaagaagctgcgtgcattgatatataaggtcatgggtcatagctagctatagta |
32288440 |
T |
 |
| Q |
201 |
tttttagtgcttag--nnnnnnnnnnncttggtgctggcaatggtgcttagttagtctgtctgtgctgct |
268 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
32288441 |
ttattagtgcttagttttttttcttttcttggtgctggcaatggtgcttagttagtctgtgtgtgttgct |
32288510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University