View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18591_high_14 (Length: 256)
Name: NF18591_high_14
Description: NF18591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18591_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 35948143 - 35947895
Alignment:
| Q |
1 |
gaaaatgacgaggatgatgaggatgttcatgattcgactcgcaagtacatttgttgcttctttggttttcttcttctcttcgctctggtttgttttattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35948143 |
gaaaatgacgaggatgatgaggatgttcatgattcgactcacaagtacatttgttgcttctttggttttcttcttctcttcgctctggtttgttttattc |
35948044 |
T |
 |
| Q |
101 |
tttgggctgttggtagaagcttcaaacctcgtgcaaaccttgaggtaacattttctatactttcatgactaggttacattgcttataaa--------tta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
35948043 |
tttgggctgttggtagaagcttcaaacctcgtgcaaaccttgaggtagcattttctatactttcatgactaggttacgttgcttataaattttaatttta |
35947944 |
T |
 |
| Q |
193 |
attttaatttaattctatgatgatcatgaggatgatttctagttgtatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35947943 |
attttaatttaattctatgatgatcatgaggatgatttttagttgtatt |
35947895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University