View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18591_high_19 (Length: 231)
Name: NF18591_high_19
Description: NF18591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18591_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 4 - 215
Target Start/End: Complemental strand, 23908447 - 23908236
Alignment:
| Q |
4 |
tatgataatttgtgtcaaaatcaagatattttttggacatgggagagaaagttagaatcgtaaattgtgtgatcgtaacatagattgtggcaaaattcca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23908447 |
tatgataatttgtgtcaaaatcaagatattttttggacatgggagagaaagttagaattgtaaattgtgtgatcgtaacatagattgtggcaaaattcca |
23908348 |
T |
 |
| Q |
104 |
agtagaaacctcaacaaccaagattttccaccaaactaagtaccgccgctctttaccacagacctttatgatccccctactagccaaagttgtttctcgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23908347 |
agtagaaacctcaacaaccaagattttccaccaaactaagtaccgccgctctttaccacagacctttatgatccccctactagccaaagttgtttctcgt |
23908248 |
T |
 |
| Q |
204 |
tatttagcctca |
215 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23908247 |
tatttagcctca |
23908236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University