View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18592_high_15 (Length: 253)
Name: NF18592_high_15
Description: NF18592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18592_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 51869249 - 51869021
Alignment:
| Q |
19 |
agtatgctccaatggcgagtattctttgaatgtgccattcacctttcctgagtttatcaaccctgctggtaagagaatgtcaaaaagagaaaagataaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51869249 |
agtatgctccaatggcgagtattctttgaatgtgccattcacctttcctgagtttatcaaccctgctggtaagagaatgtcaaaaagagaaaagataaga |
51869150 |
T |
 |
| Q |
119 |
ctgaatgtggatgttgttgctggaagtgagcttctgttcaagacaactagccatcccctacaggttggtatttggttggcttttcacatatgggactgtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51869149 |
ctgaatgtggatgttgttgctggaagtgagcttctgttcaagacaactagccatcccctacaggttggtatttggttggcttttcacatacgggactgtt |
51869050 |
T |
 |
| Q |
219 |
gcagtgttttcaatggccggttcatttca |
247 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |
|
|
| T |
51869049 |
gcagtgttttcaatggccgattcttttca |
51869021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 115
Target Start/End: Original strand, 18568263 - 18568334
Alignment:
| Q |
44 |
ttgaatgtgccattcacctttcctgagtttatcaaccctgctggtaagagaatgtcaaaaagagaaaagata |
115 |
Q |
| |
|
||||||||||||||||||||||| || || | ||||||||||| ||||||||| |||| |||||||||| |
|
|
| T |
18568263 |
ttgaatgtgccattcacctttccggatttcgttaaccctgctgggaagagaatgggtaaaaaagaaaagata |
18568334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University