View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18592_high_3 (Length: 465)
Name: NF18592_high_3
Description: NF18592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18592_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 425; Significance: 0; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 17 - 453
Target Start/End: Complemental strand, 11110272 - 11109836
Alignment:
| Q |
17 |
aaacacatcataaccaaaataaatatataaacaacgataatgtaggtgaaaaacttgtgttataaaagagcaaatataacaacacttaaaagtgcatcga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11110272 |
aaacacatcataaccaaaataaatatataaacaacgatgatgtaggtgaaaaacttgtgttataaaagagcaaatataacaacacttaaaagtgcatcga |
11110173 |
T |
 |
| Q |
117 |
acagaagtttaaacaaaatttaagcaaaagcctaaaaaatatctaaggtttaggtaagtctggctaagatctgggcaagggtgttccgaatatgagcttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11110172 |
acagaagtttaaacaaaatttaagcaaaagcctaaaaaatatctaaggtttaggtaagtctggctaagatctgggcaagggtgttccgaatatgagcttg |
11110073 |
T |
 |
| Q |
217 |
acttgctaacacatcttcatgccgcttgttagagatctcaatgaactggtctatcttctcagcttgcttctcaatatcttccttagttgcaaattttggt |
316 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11110072 |
acttgctaacacgtcttcatgccgcttgttagagatctcaatgaactggtctatcttctcagcttgcttctcaatatcttccttagttgcaaattttggt |
11109973 |
T |
 |
| Q |
317 |
tctgttgcttcttttcgtgcggtgacaggttttccaatcaaagatgcattaagcaattgtacatatgcagcagattttgcaagtgcttcttctggagccg |
416 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109972 |
tctgttgcttcttttcgtgcagtgacaggttttccaatcaaagatgcattaagcaattgtacatatgcagcagattttgcaagtgcttcttctggagccg |
11109873 |
T |
 |
| Q |
417 |
ggacaggttttccaatcaagtcccatttgtcaagtat |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109872 |
ggacaggttttccaatcaagtcccatttgtcaagtat |
11109836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 447
Target Start/End: Complemental strand, 11108909 - 11108845
Alignment:
| Q |
383 |
gcagcagattttgcaagtgcttcttctggagccgggacaggttttccaatcaagtcccatttgtc |
447 |
Q |
| |
|
||||||||| |||| ||||||||| ||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
11108909 |
gcagcagatagtgcaggtgcttcttttggtgccgggtcaggttttccaatcaagtcacatttgtc |
11108845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 447
Target Start/End: Complemental strand, 11112175 - 11112112
Alignment:
| Q |
384 |
cagcagattttgcaagtgcttcttctggagccgggacaggttttccaatcaagtcccatttgtc |
447 |
Q |
| |
|
||||||||| || | ||||||||| ||| ||| |||||||||||||||||||||| |||||||| |
|
|
| T |
11112175 |
cagcagattgtgaaggtgcttcttttggtgccaggacaggttttccaatcaagtcacatttgtc |
11112112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 447
Target Start/End: Complemental strand, 11117258 - 11117195
Alignment:
| Q |
384 |
cagcagattttgcaagtgcttcttctggagccgggacaggttttccaatcaagtcccatttgtc |
447 |
Q |
| |
|
||||||||| |||| | |||||| ||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
11117258 |
cagcagattgtgcaggatcttcttttggtgccgggtcaggttttccaatcaagtcacatttgtc |
11117195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University