View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18592_low_11 (Length: 354)
Name: NF18592_low_11
Description: NF18592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18592_low_11 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 128 - 228
Target Start/End: Complemental strand, 10995716 - 10995616
Alignment:
| Q |
128 |
gacaaggcatcagcagcaatattatccttgcctggcttatattcaatagtgaaatcaaatcccaaaaacttatgcaaccatttttgttgttctggggttt |
227 |
Q |
| |
|
|||||||||||||| | ||| |||||| |||||||||| ||||||||| |||||||| || | |||||| || |||||| |||||||||||| |||| |
|
|
| T |
10995716 |
gacaaggcatcagctggaatgttatccatgcctggcttgtattcaatatgaaaatcaaagccaataaacttgtgtaaccatgcttgttgttctggagttt |
10995617 |
T |
|
| Q |
228 |
g |
228 |
Q |
| |
|
| |
|
|
| T |
10995616 |
g |
10995616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 205 - 238
Target Start/End: Original strand, 8972577 - 8972610
Alignment:
| Q |
205 |
ccatttttgttgttctggggtttgaatagtttga |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8972577 |
ccatttttgttgttctggggtttgaatagtttga |
8972610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 43610 - 43555
Alignment:
| Q |
281 |
aatttatgacccagaatatagtgtctaaatttagccatagcctcagtaactgcata |
336 |
Q |
| |
|
|||||||| || |||||||||||||| ||||| |||||||| ||||| |||||||| |
|
|
| T |
43610 |
aatttatggcctagaatatagtgtctgaattttgccatagcttcagtgactgcata |
43555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University