View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18592_low_13 (Length: 308)
Name: NF18592_low_13
Description: NF18592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18592_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 291
Target Start/End: Complemental strand, 31524216 - 31523939
Alignment:
| Q |
14 |
gaaggagggagggttaagtttgtgagtgcggatttgatgaaaggtatggagtggcgcattgttagaaagatgcgggtgcagacggtggcggagacgggga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31524216 |
gaaggagggagggttaagtttgtgagtgcagatttgatggaaggtatggaatggcgcattgttagaaagatgcgggtgcagacggtggcggagacgggga |
31524117 |
T |
 |
| Q |
114 |
ggagggaggaaatgtttggtgatgggatttggatgatgttgtagagtgaggggttggtggctgatttgagaatatgagattcagtgtgtgaggtttgaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31524116 |
ggagggaggaaatgtttggtgatgggatttggatgatgttgtagagtgaggggttggtggctgatttgagaatatgagattcagtgtgtgaggtttgaga |
31524017 |
T |
 |
| Q |
214 |
agtgatggcgaggattgtgagtttgaaattgtggtggatttggaagcgtttagctagctcgatgataggcatgagatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31524016 |
agtgatggcgaggattgtgagtttgaaattgtggtggatttggaagcgtttagctagctcgatgataggcatgagatg |
31523939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University