View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18593_high_33 (Length: 220)
Name: NF18593_high_33
Description: NF18593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18593_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 16823512 - 16823321
Alignment:
| Q |
10 |
gtgagaagaaggagtctatggacaacaatggtttgactaaaatgtttgtgccgaaggagctgtgtttagctaaactccttgcagaatgcttttggggcaa |
109 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16823512 |
gtgagaagaaggaatctatgaacaacaatggtttgactaaaatgtttgtgccgaaggagctgtgtttagctaaactccttgcagaatgcttttggggcaa |
16823413 |
T |
|
| Q |
110 |
caagaatacaatgaagaagggttcaattgtgttggaggtgaaggatggcaacgatgattggcgagatagagatacacgatcaccgccggttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16823412 |
caagaatacaatgaagaaggattcaattgtgttggaggtgaaggatggcaacgatgattggcgagatagagatacacggtcaccgccggttt |
16823321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University