View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18593_high_36 (Length: 206)
Name: NF18593_high_36
Description: NF18593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18593_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 2 - 197
Target Start/End: Original strand, 2097621 - 2097816
Alignment:
| Q |
2 |
accttcgattgaatctgtaaggcgacagaacaccagatgcatctcttgctgcccatgcaaggcaatcttcaccaacaccttcagaactcatagctattct |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097621 |
accttcgattgaatttgtaaggcgacagaacaccagatgcatctcttgctgcccatgcaaggcaatcttcaccaacaccttcagaactcatagctattct |
2097720 |
T |
 |
| Q |
102 |
attcaaacataataacataattaattagtcctcaattcatttcatataattcatttctaataaatcaaacaaattatggattcatgcaagaataat |
197 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2097721 |
actcaaacataataacataattaattagtcctcaattcatttcatataattaatttctaataaatcaaacaaattatggattcatgcaaggataat |
2097816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University