View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18593_low_29 (Length: 248)
Name: NF18593_low_29
Description: NF18593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18593_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 42772352 - 42772585
Alignment:
| Q |
1 |
aattgaataaattatggcgaaatatgttttagaaaaattaatagaattattattggcaaatatatatggactatgatagaataatttcggaagtaagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42772352 |
aattgaataaattatggcgaaatatgttttagaaaaattaatagaattattattggcaaatatatatggactatgatagaataatttcggaagtaagatg |
42772451 |
T |
|
| Q |
101 |
cagatttcattaactctcagatttcattgatttattcatcaatattgttaactaattacaggagttgatatttaattcgaacgctaattttggcacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42772452 |
cagatttcattaactctcagatttcattgatttattcatcaatattgttaactaataacaggagttgatatttaattcgaacgctaattttggcacaaat |
42772551 |
T |
|
| Q |
201 |
gttgccttttatttatacaatgaacgagcaaaat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42772552 |
gttgccttttatttatacaatgaacgagcaaaat |
42772585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University