View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18593_low_30 (Length: 243)

Name: NF18593_low_30
Description: NF18593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18593_low_30
NF18593_low_30
[»] chr7 (1 HSPs)
chr7 (1-243)||(47953704-47953942)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 47953704 - 47953942
Alignment:
1 gcaaaatattgaagtggagcttgatgattagnnnnnnnaagcactttaatgatgtatttctttctgaaagtagaggcattaccaccttagagaaggtcca 100  Q
    |||||||||||||||||||||||||||||||       ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47953704 gcaaaatattgaagtggagcttgatgattagtttttttaagtactttaatgatgtatttctttctgaaagtagaggcattaccaccttagagaaggtcca 47953803  T
101 attggcaattaggacgaatgagctaaccgttcttaaaggctcaaaggtgaaagatagtggtgaatacctaagtatcaagaggaagaggtaggagtagaag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
47953804 attggcaattaggacgaatgagctaaccgttcttaaaggctcaaaggtgaaagatactggtgaatacctaagtatcaagaggaagaggtaggagtagaag 47953903  T
201 aaacaaggaaagatcgatcaaaattaagagggaacaacaaatc 243  Q
    |||||||||||    ||||||||| |||||||||| |||||||    
47953904 aaacaaggaaa----gatcaaaatcaagagggaacgacaaatc 47953942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University