View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18593_low_30 (Length: 243)
Name: NF18593_low_30
Description: NF18593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18593_low_30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 47953704 - 47953942
Alignment:
| Q |
1 |
gcaaaatattgaagtggagcttgatgattagnnnnnnnaagcactttaatgatgtatttctttctgaaagtagaggcattaccaccttagagaaggtcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47953704 |
gcaaaatattgaagtggagcttgatgattagtttttttaagtactttaatgatgtatttctttctgaaagtagaggcattaccaccttagagaaggtcca |
47953803 |
T |
 |
| Q |
101 |
attggcaattaggacgaatgagctaaccgttcttaaaggctcaaaggtgaaagatagtggtgaatacctaagtatcaagaggaagaggtaggagtagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47953804 |
attggcaattaggacgaatgagctaaccgttcttaaaggctcaaaggtgaaagatactggtgaatacctaagtatcaagaggaagaggtaggagtagaag |
47953903 |
T |
 |
| Q |
201 |
aaacaaggaaagatcgatcaaaattaagagggaacaacaaatc |
243 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
47953904 |
aaacaaggaaa----gatcaaaatcaagagggaacgacaaatc |
47953942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University