View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18594_high_8 (Length: 268)
Name: NF18594_high_8
Description: NF18594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18594_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 32083083 - 32082846
Alignment:
| Q |
17 |
gtgattggataattcatatccgaaggttgactctaatccatacgtatgagttgtatccgtgtcaagtgtcattcaaagttgattgaacnnnnnnntacta |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32083083 |
gtgattggataattcatatcctaaggttgactataatccatacgtatgagttgtatccgtgtcaagtgtcattcaaagttgattgaacaaaaaaatacta |
32082984 |
T |
 |
| Q |
117 |
aaagcaggaatatccaaaagcatatgacatataacaagaatattccttgcggagatcccgttggcatttcattatctttttcacaatggatattgccaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32082983 |
aaagcaggaatatccaaaagcatatgacatataacaagaatattccttgcggagatcccgttggcatttcattatctttttcacaatggatattgccaaa |
32082884 |
T |
 |
| Q |
217 |
ttctctcaaataaatacccaaaggtttctctcccacct |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32082883 |
ttctctcaaataaataccccaaggtttctctcccacct |
32082846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University