View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18594_low_10 (Length: 268)

Name: NF18594_low_10
Description: NF18594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18594_low_10
NF18594_low_10
[»] chr7 (1 HSPs)
chr7 (17-254)||(32082846-32083083)


Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 32083083 - 32082846
Alignment:
17 gtgattggataattcatatccgaaggttgactctaatccatacgtatgagttgtatccgtgtcaagtgtcattcaaagttgattgaacnnnnnnntacta 116  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||    
32083083 gtgattggataattcatatcctaaggttgactataatccatacgtatgagttgtatccgtgtcaagtgtcattcaaagttgattgaacaaaaaaatacta 32082984  T
117 aaagcaggaatatccaaaagcatatgacatataacaagaatattccttgcggagatcccgttggcatttcattatctttttcacaatggatattgccaaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32082983 aaagcaggaatatccaaaagcatatgacatataacaagaatattccttgcggagatcccgttggcatttcattatctttttcacaatggatattgccaaa 32082884  T
217 ttctctcaaataaatacccaaaggtttctctcccacct 254  Q
    ||||||||||||||||||| ||||||||||||||||||    
32082883 ttctctcaaataaataccccaaggtttctctcccacct 32082846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University