View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18594_low_12 (Length: 213)
Name: NF18594_low_12
Description: NF18594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18594_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 141
Target Start/End: Original strand, 22394806 - 22394928
Alignment:
| Q |
19 |
atggaatttcgtgactatatcctagcattggaagaagaaaagaagaaaattcaggttttccctagagaccttcctctttctcttgagcttgttacacaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22394806 |
atggaatttcgtgactatatcctagcattggaagaagaaaagaagaaaattcaggttttccctagagaccttcctctttctcttgagcttgttacacaag |
22394905 |
T |
 |
| Q |
119 |
gtaaacaaaacaaaccagaagaa |
141 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22394906 |
gtaaacaaaacaaaccagaagaa |
22394928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University