View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18594_low_5 (Length: 417)
Name: NF18594_low_5
Description: NF18594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18594_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Original strand, 43015385 - 43015776
Alignment:
| Q |
1 |
caatggaagaagagatagtggaagtggaagttcttcttctaaggaaattgttactcagattcatagagatgaaatgtctgctgttgttggtgtccctagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015385 |
caatggaagaagagatagtggaagtggaagttcttcttctaaggaaattgttactcagattcatagagatgaaatgtctgctgttgttggtgtccctagt |
43015484 |
T |
 |
| Q |
101 |
cctttaacaagcttcacaaatgctttggatattcaacaccttaaatctgatcattttggcttcatcccatttcgaaaaagctatgatgaagtaagttaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015485 |
cctttaacaagcttcacaaatgctttggatattcaacaccttaaatctgatcattttggcttcatcccatttcgaaaaagctatgatgaagtaagttaca |
43015584 |
T |
 |
| Q |
201 |
tatattatacagtaagacacttatgattgaagatatgtctagtgtttgacacatgttcatgtctgacaccgacatatatagttacattcaaccactttca |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| | |
|
|
| T |
43015585 |
tatattatacagtaagacacttctgattgaagatatgtctagtgtttgacacatgttcatgtctgacaccgacatatatagttacaatcaaccattttta |
43015684 |
T |
 |
| Q |
301 |
ttttttcaaattacggcttgcatcaatgtcttacttttgtgtccggaatatgtgcaagtttttcatataaatcatggttcattaaacccact |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
43015685 |
ttttttcaaattacggcttgcatcaatgtcttacttttgtgtccggaatatgtgcaagtgtttcatataaatcatcgttcattaaacccact |
43015776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University