View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18595_high_6 (Length: 224)
Name: NF18595_high_6
Description: NF18595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18595_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 8658453 - 8658263
Alignment:
| Q |
16 |
gaatagacatatagctctgagaagaaacataatccccatgtctggtaggaaaccagcacagaatagtgaggtcattccaacgacacaaaatagccaagta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8658453 |
gaatagacatatagctctgagaagaaacataatccccatgtctggtaggaaaccagcacagaatagtgaggtcattccaacgacacaaaatagccaagta |
8658354 |
T |
|
| Q |
116 |
tagatggtaggcccatccagaatttgccttttcctctgtttccagtaagatatggtagaatccatcccctctcgcgaggtcaccatgggaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8658353 |
tagatggtaggcccatccagaatttgccttttcctctgtttccagtaagatatggtagaatccatcccctctcgcgaggtcaccatgggaa |
8658263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University