View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18595_low_4 (Length: 246)
Name: NF18595_low_4
Description: NF18595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18595_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 31727421 - 31727183
Alignment:
| Q |
1 |
tatgtttatatcaaattacgaatcactcataaagatacagacattaaacacaacactgatatgtcgagactaataataactctagaaacttaatgtaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31727421 |
tatgtttatatcaaattacgaatcactcataaagatacagacaccaaatacaacactgatatgtcgagactaataataactctagaaacttaatgtaatc |
31727322 |
T |
|
| Q |
101 |
acgtgtcggtgtcaagccattgtcggacacttgcacatttggatgcgtcagacatcgaacacgtcttctatcagaagtgtcgtgctacgtagtatcagaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31727321 |
acatgtcggtgtcaagccattgtcggacacttgcacatttggatgcgtcaaacatcgaacacgtcttctatcagaagtgtcgtgctacgtggtatcagaa |
31727222 |
T |
|
| Q |
201 |
aaactaattactccaaggatttttaatgaatgatgatgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31727221 |
aaactaattactccaaggatttttaatgaatgatgatgt |
31727183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University